Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Human Prostate Tumor Tissue and IHC Staining

    2020-08-12


    Human Prostate Tumor Tissue and IHC Staining
    This study was approved by the ethical committee of Fudan University Shanghai Cancer Center (FUSCC), and each patient signed the consent form before participation (No.050432-4-1212B). Human prostate cancer tumor tissue arrays were provided by FUSCC. The arrays were stained by using the Histostain-plus IHC Kit (Miao Tong Biological Science and Technology Co.Ltd, Shanghai, China) as described previously (Liao et al., 2014). Briefly, the tissue sections were deparaffinized and incubated in citrate buffer at 95 C for 40 mins for antigen retrieval and then incubated overnight at 4 C with the primary antibodies. After three times washing, tissue sections were incubated with biotinylated anti-rabbit IgG for 1 hr at room temperature and then washed three times, after which streptavidin–horseradish peroxidase conjugates were added and the slides were incubated for 45 mins. After three washes with PBS, DAB solution was added and the slides were counterstained with haematoxylin. The stained slides were examined under a microscope, and images were acquired. Staining intensity was scored in a blinded manner.
    METHOD DETAILS
    Alkaline Phosphatase (AP) Staining
    Alkaline Phosphatase staining was performed using a leukocyte AP kit (Sigma, catalog No 85L3R) according to the manufacturer’s pro-tocol. Briefly, the cultured 58-58-2 were fixed with 4% paraformaldehyde (PFA) in PBS for 30 s and rinsed three times with PBS, then the cells were incubated at room temperature in the solution containing naphthol AS-BI phosphate and fresh fast red violet LB salt for 15 mins.
    In Vitro Phosphorylation Assay
    Flag-BRAF was expressed in HEK293T cells and purified using M2 beads for immunoprecipitation and eluted using Flag peptide, purified Flag-BRAF was incubated with 0.5 mg His-NANOG in 50 ml of kinase buffer (25mM Tris-HCl (pH 7.5), 5 mM glycerophosphate, 10 mM MgCl2, 1mM DTT and 0.1 mM Na3VO4) containing 100 mM ATP at 30 C for 1 hr. The reaction was terminated by the addition of
    17 ml of 4XLaemmli SDS sample buffer. The reaction mixtures were boiled and separated by SDS–PAGE and phosphorylation NANOG was immunobloted by anti-pSer68-NANOG antibody.
    Sphere Formation Assay
    Oncosphere assays were performed as previously described (Liu et al., 2007). Oncospheres were enriched from DU145 cells. Single-cell suspension of DU145 and PC3 cells (200 cells per well, repeat 10 holes in each group) were plated on 96-well ultra-low Attachment Plates (Corning Incorporated, catalog number: 3474) and cultured in Dulbecco’s Modified Eagle’s Medium/F12 (Gibco) supplemented with 5 mg/ml insulin (Sigma), 20 ng/ml EGF (Sigma), 1:50 B27 (Gibco), 10 ng/ml bFGF, and 0.4% BSA for 10 days alone. Floating spheres that grew in 2 weeks were counted. Tumor spheres were visualized under phase contrast microscope, photographed and counted and represented graphically. Tumor spheres larger than 100 mm were counted, and the ‘‘relative % of sphere’’ represent the relative increase number of sphere per dish. Spheres were digested with trypsin 0.05% EDTA and filtered through a 40 mm filter.
    RNA Interference
    Non-specific control siRNA and siRNAs for SPOP, Cullins and BRAF were purchased from GenePharma. siRNA transfection of cells was performed according to the manufacturer’s instructions. Briefly, siRNA and Lipofectamine 2000 reagent were mixed and incu-bated in serum-free 1640 medium for 15 mins at room temperature, respectively, and then added to cells with 70% confluence. Virus was produced by transfected 293T cells, by harvesting the viral supernatant 48-72 hrs after transfection, passed through 0.45 mm filter, diluted 2:3 with fresh medium containing 2 mg/ml polybrene and used to infect the target cells at 70% confluence. shRNA target sequences:
    SPOP shRNA1: CCAAGGGAGAAGAAACCAA,
    SPOP shRNA2: CAACUAUCAUGCUUCGGAU,
    SPOP shRNA (3-UTR): CUCCGUUUAAUUUCCAGAATT,
    NANOG shRNA: UGAUUGUUCCAGGAUUGGGUG,
    Scramble shRNA: TTCTCCGAACGTGTCACGTTT.
    Generation of the SPOP KO Cell Lines
    SPOP knockout cell lines were generated using lentiCRISPR methods (Shalem et al., 2014). Briefly, guide RNA (sgRNA) was constructed into the lentiviral expression vector for Cas9 and sgRNA (lentiCRISPR). The lentiCRISPR vector was linearized using BsmBI. The sequence of sgRNA is:
    sgRNA SPOP-1# : CACCGGGTTCCAAGTCCTCCACCTC, sgRNA SPOP-2# : CACCGGGGAGGATTTGGTGGACGAA.
    Real-Time Quantitative PCR
    Total RNAs were extracted with TriZol (sigma) from various cells by RNA preparation kit as indicated. After their quantification using a Nanodrop 1000 spectrophotometer (Thermo Scientific), one microgram of total RNA was reverse-transcribed into complementary